Review



xenium human multi tissue and cancer panel  (10X Genomics)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    10X Genomics xenium human multi tissue and cancer panel
    Xenium Human Multi Tissue And Cancer Panel, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/xenium+human+multi-tissue+and+cancer+panel/cancer+panel/pmc12903365-82-0-7
    Average 86 stars, based on 1 article reviews
    xenium human multi tissue and cancer panel - by Bioz Stars, 2026-10
    86/100 stars

    Images

    Related Articles

    Hybridization:

    Article Title: Genital herpes shedding episodes associate with alterations in the spatial organization and activation of mucosal immune cells
    Article Snippet: .. Tissue sections were then fixed in paraformaldehyde and permeabilized following the protocol CG000581 Rev C. Probe hybridization of 377 genes in the Xenium Human Multi-Tissue and Cancer panel (10x Genomics, 2023), ligation, and amplification were performed as instructed in CG000582 Rev E, followed by nuclei staining and removal of background fluorescence. .. Imaging and decoding of fluorescent probe optical signatures were performed onboard the 10x Genomics Xenium platform (software version 1.7.6.0 and analysis version xenium-1.7.1.0) with additional analysis to detect the abundance and localization of mRNA transcripts.

    Ligation:

    Article Title: Genital herpes shedding episodes associate with alterations in the spatial organization and activation of mucosal immune cells
    Article Snippet: .. Tissue sections were then fixed in paraformaldehyde and permeabilized following the protocol CG000581 Rev C. Probe hybridization of 377 genes in the Xenium Human Multi-Tissue and Cancer panel (10x Genomics, 2023), ligation, and amplification were performed as instructed in CG000582 Rev E, followed by nuclei staining and removal of background fluorescence. .. Imaging and decoding of fluorescent probe optical signatures were performed onboard the 10x Genomics Xenium platform (software version 1.7.6.0 and analysis version xenium-1.7.1.0) with additional analysis to detect the abundance and localization of mRNA transcripts.

    Amplification:

    Article Title: Genital herpes shedding episodes associate with alterations in the spatial organization and activation of mucosal immune cells
    Article Snippet: .. Tissue sections were then fixed in paraformaldehyde and permeabilized following the protocol CG000581 Rev C. Probe hybridization of 377 genes in the Xenium Human Multi-Tissue and Cancer panel (10x Genomics, 2023), ligation, and amplification were performed as instructed in CG000582 Rev E, followed by nuclei staining and removal of background fluorescence. .. Imaging and decoding of fluorescent probe optical signatures were performed onboard the 10x Genomics Xenium platform (software version 1.7.6.0 and analysis version xenium-1.7.1.0) with additional analysis to detect the abundance and localization of mRNA transcripts.

    Staining:

    Article Title: Genital herpes shedding episodes associate with alterations in the spatial organization and activation of mucosal immune cells
    Article Snippet: .. Tissue sections were then fixed in paraformaldehyde and permeabilized following the protocol CG000581 Rev C. Probe hybridization of 377 genes in the Xenium Human Multi-Tissue and Cancer panel (10x Genomics, 2023), ligation, and amplification were performed as instructed in CG000582 Rev E, followed by nuclei staining and removal of background fluorescence. .. Imaging and decoding of fluorescent probe optical signatures were performed onboard the 10x Genomics Xenium platform (software version 1.7.6.0 and analysis version xenium-1.7.1.0) with additional analysis to detect the abundance and localization of mRNA transcripts.

    Fluorescence:

    Article Title: Genital herpes shedding episodes associate with alterations in the spatial organization and activation of mucosal immune cells
    Article Snippet: .. Tissue sections were then fixed in paraformaldehyde and permeabilized following the protocol CG000581 Rev C. Probe hybridization of 377 genes in the Xenium Human Multi-Tissue and Cancer panel (10x Genomics, 2023), ligation, and amplification were performed as instructed in CG000582 Rev E, followed by nuclei staining and removal of background fluorescence. .. Imaging and decoding of fluorescent probe optical signatures were performed onboard the 10x Genomics Xenium platform (software version 1.7.6.0 and analysis version xenium-1.7.1.0) with additional analysis to detect the abundance and localization of mRNA transcripts.

    other:

    Article Title: Open-ST: High-resolution spatial transcriptomics in 3D.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER HS RNA tapestation Agilent 5067-5579/ - 5580/ -5581 Blue S’Green qPCR mix Biozym Cat#331416 KAPA LQ Primer + Mastermix (Illumina/ LC480) Roche Cat#7960573001 KAPA Library Quantification DNA Standards (Illumina) Roche Cat#7960387001 Phosphate Buffered Saline (10X), pH 7.4, RNase-free Invitrogen Cat#10055154 Tween 20 Surfact-Amps detergent solution Thermo Scientific Cat#85113 Ethanol denatured 96% Serva Electrophoresis Cat#11096.02 Dimethyl Sulfoxide (DMSO) Sigma Cat#D8418-1L KCl (2M), RNase-free Life Technologies Cat#AM9640G Formaldehyde, for molecular biology, 36.5-38% in H2O Sigma-Aldrich Cat#F8775 Triton-X-100 Sigma-Aldrich Cat#T8787 Normal Donkey Serum Biozol Diagnostica Cat#SBA-0030-01 DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) Bio-Trend Cat##40011 Glycerol, ROTIPURAN R99,5 %, p.a, anhydrous Roth Cat#3783.2 DPBS, no calcium, no magnesium Gibco Cat#14190169 Critical commercial assays NovaSeq 6000 S4 reagent kit v1.5 (35 cycles) Illumina Cat#20044417 Xenium Human Multi-Tissue and Cancer Panel 10X Genomics Panel number 1000626 Xenium Slides & sample Prep reagents 10X Genomics 1000460 Xenium Decoding Reagent Module A 10X Genomics 1000624 Xenium Decoding Reagent Module B 10X Genomics 1000625 Xenium Decoding Consumables 10X Genomics 1000487 Deposited data Open-ST (this publication) GEO GSE251926 10x Xenium HNSCC and metastatic lymph node (this publication) GEO GSE263498 Immunofluorescence images of metastatic lymph node section #1(this publication) Zenodo https://doi.org/10.5281/zenodo.11395256 Slide-seqV2 E9.5 mouse brain data GEO GSE197353 Seq-Scope mouse liver data GEO GSE169706 Stereo-seq CNGB Sequence Archive CNX0422301 10X Visium 10X Genomics https://www.10xgenomics.com/resources/ datasets/mouse-brain-serial-section-2sagittal-anterior-1-standard DBiT-seq E11 mouse embryo GEO GSE137986 Single-cell RNA seq of primary and metastatic tumor of HNSCC GEO GSE103322 Allen Developing Mouse Brain Atlas ISH data Allen Institute http://developingmouse.brain-map.org/; RRID: SCR_002990 Oligonucleotides HDMI32-DraI: CAAGCAGAAGACGGCATACGAGAT TCTTTCCCTACACGACGCTCTTCCGATCTNNVNBV NNVNNVNNVNNVNNVNNVNNVNNNNNTCTTGTGA CTACAGCACCCTCGACTCTCGCTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTAAAGACTTTCACCAGTCCATG ATGTGTAGATCTCGGTGGTCGCCGTATCATT Cho et al.16 N/A Randomer: TCAGACGTGTGCTCTTCCGATCT NNNNNNNNN Cho et al.16 N/A Read1-DraI: ATCATGGACTGGTGAAAGTCTT TAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA GCGAGAGTCGAGGGTGCTGTAGTCACAAGA Cho et al.16 N/A (Continued on next page) ll OPEN ACCESS e2 Cell 187, 3953–3972.e1–e13, July 25, 2024 Article



    Similar Products

    xenium human multi tissue and cancer panel  (10X Genomics)
    86
    10X Genomics xenium human multi tissue and cancer panel
    Xenium Human Multi Tissue And Cancer Panel, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/xenium+human+multi-tissue+and+cancer+panel/cancer+panel/pmc12903365-82-0-7
    Average 86 stars, based on 1 article reviews
    xenium human multi tissue and cancer panel - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    xenium human multi-tissue and cancer panel  (10X Genomics)
    90
    10X Genomics xenium human multi-tissue and cancer panel
    Xenium Human Multi Tissue And Cancer Panel, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/xenium+human+multi-tissue+and+cancer+panel/xenium+human+multi+tissue+and+cancer+panel/bio_rxiv__2025__06__24__661157-318-26-28
    Average 90 stars, based on 1 article reviews
    xenium human multi-tissue and cancer panel - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    pre-designed gene expression probe set xenium human multi-tissue and cancer panel  (10X Genomics)
    90
    10X Genomics pre-designed gene expression probe set xenium human multi-tissue and cancer panel
    Pre Designed Gene Expression Probe Set Xenium Human Multi Tissue And Cancer Panel, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/xenium+human+multi-tissue+and+cancer+panel/xenium+human+multi+tissue+and+cancer+panel/bio_rxiv__2023__12__13__571385-184-20-23
    Average 90 stars, based on 1 article reviews
    pre-designed gene expression probe set xenium human multi-tissue and cancer panel - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results